Clinical activity of Pan-HER inhibitors against HER2 mutant lung adenocarcinoma
Abstract
Introduction: HER2 mutations are found in 2%–4% of non–small cell lung cancer (NSCLC) cases and are usually mutually exclusive with other genetic alterations. In this study, we screened a large cohort of patients from multiple institutions in Korea, described the characteristics of HER2-mutant cases, and reported on several patients who were treated with pan-HER inhibitors.Materials and Methods: The study population consisted of 360 patients diagnosed with adenocarcinoma from four institutions in Korea from June 2015 to September 2016. Tissue specimens from all participants were screened by direct sequencing, and next-generation sequencing (NGS) was conducted only on specimens that were positive in direct sequencing. HER2-targeted therapy, either poziotinib or afatinib, was orally administrated.
Results: NGS was conducted in 129 patients, and finally, 29 (8.1%) patients with HER2- mutation were identified. Most patients were female (58.6%), had never smoked (70.0%),and had stage IV NSCLC (55.2%). For all patients, the histological type was adenocarcinoma, with no coexisting EGFR or ALK alterations. The most common type of HER2 mutation (48.3%) was c.2326_2327insTGT in exon 20. A partial response was observed in two patients who received poziotinib and one patient who received afatinib. The main toxicities of the pan-HER inhibitors were nausea, diarrhea, and mucositis.Conclusions: HER2 mutation was estimated at a frequency of approximately 8.1% in Korean patients with adenocarcinoma in the absence of known driver mutations. Because some of the HER2 mutant cases responded to poziotinib or afatinib, further studies are warranted.
Introduction
New targetable oncogenes beyond the epidermal growth factor receptor (EGFR) mutation and anaplastic lymphoma kinase (ALK) rearrangement have been discovered in non–small cell lung cancer (NSCLC)1. Human epidermal growth factor receptor 2 (HER2) is a member of the ERBB receptor tyrosine kinase family. HER2 receptor is activated by homodimerization or heterodimerization with the other ERBB family receptors, especially EGFR, thereby resulting in an augmentation of EGFR signaling2. Oncogenic activation of HER2 occurs in various malignancies including those of the breast, stomach, lung, bladder, ovarian, and pancreatic cancer3. In NSCLC, HER2 gene mutations occur in exons 18–21 of the tyrosine kinase domain and are typically associated with adenocarcinoma histology in never smokers and women4,5. HER2 mutations are seen in 2-4% of NSCLC and usually mutually exclusive with EGFR, KRAS, and ALK gene alterations4,6. In a selected population of
EGFR/KRAS/ALK-negative patients, the HER2-positive incidence can reach up to 6%5,7. To date, there is no standard of care for these patients.The benefit of HER2-targeted therapy for NSCLC is much less defined than that for breast cancer4. HER2 positivity appears to confer relative resistance to the standard doublet regimens of platinum-containing chemotherapy used in NSCLC 4,8. The National Comprehensive Cancer Network (NCCN) has included trastuzumab and afatinib as potential therapeutic options for patients with NSCLC along with HER2 mutations9. Poziotinib (HM781-36B) is a novel oral, irreversible pan-HER inhibitor. In preclinical studies conducted in cell lines and xenograft models, poziotinib was the most potent inhibitor of EGFR, including the EGFR-acquired resistance mutation (T790M), as well as HER2 and HER4, compared with other EGFR tyrosine kinase inhibitors (erlotinib, lapatinib, and afatinib) 10. In this study, we screened a large cohort of patients from multiple institutions in Korea and found HER2 mutations in 29 patients with adenocarcinoma. We describe the unique clinical and molecular characteristics of this cohort as well as the results of treatment with pan-HER inhibitors in several cases.
The study population was composed of 360 patients who were diagnosed with adenocarcinoma in four institutions in Korea from June 2015 to September 2016. The study was approved by the institutional review boards (IRBs) of each study institution and conducted in accordance with the Declaration of Helsinki and Good Clinical Practice Guidelines. Demographic and clinical characteristics were collected from each patient by the treating physician under IRB-approved retrospective review protocol. Histology was assessed by experienced local pathologists following the criteria of the World Health Organization and the last classification of the International Association for the Study of Lung Cancer (IASLC)11. The clinicopathological stage was locally assigned, according to the 7th Tumor Node Metastasis classification12. Poziotinib was provided to participants in the clinical trial of Korea Association for the Study of Targeted Therapy (ClinicalTrials.gov ID: NCT02979821) after written informed consent.All participating centers had accredited and quality-controlled diagnostic laboratories that routinely tested NSCLC for EGFR and ALK. EGFR gene mutations were detected by real- time polymerase chain reaction (PCR) using the PNA Clamp Mutation Detection Kit (Panagene Inc., Daejeon, Korea) according to the manufacturer’s protocol 13-15. ALK rearrangements were detected by immunohistochemistry or fluorescence in situ hybridization (FISH) using the commercially available ALK probe (Vysis LSI ALK Dual Color, Break Apart Rearrangement Probe; Abbott Molecular, Abbott Park, IL, USA).
We performed two different methods of molecular testing for HER2 of the biopsy samples at the central laboratory.Biopsy samples from all participants were screened by direct sequencing, and next-generation sequencing (NGS) of samples was only conducted in those that had a positive result by direct sequencing.1) HER2 exon 20 direct sequencingAll samples were screened for mutation in HER2 exon 20 by direct sequencing with 200 ng of DNA. Direct sequencing was performed on all samples with HER2_ex20_seqR primer (CCAGTTCAGCAGGTCCTGG) and HER2_ex20R primer (TCCGGAGAGACCTGCAAAGA) at Macrogen (Seoul, Korea) using a 3730XL DNA analyzer (Perkin-Elmer Applied Biosystems, Foster City, CA, USA).2)HER2 exon 20 NGSFor conventional 454-targeted sequencing, 10 ng of DNA was used in the PCR of the HER2 panel (Seasun Biomaterials, Daejeon, Korea). Subsequent processing of the samples was performed according to the manufacturer’s protocol. Purified amplicons were quantified by Pico-Green (Life Technologies, Carlsbad, CA, USA) using an external Infinite F200Pro fluorometer (Tecan, Grödig, Austria) with Magellan v7.0 software (Tecan, Grödig, Austria). Based on the standard concentrations, the signals were directly translated to ng/µL, and the coefficient of determination (validation criteria R2 > 0.99) was calculated from eight DNA standards ranging from 0 to 100 ng/µL.For emulsion PCR amplification, the concentrations of the amplicons were converted to molecules/microliter according to the respective amplicon length. Pyrosequencing was carried out using the GS Junior System (Roche Diagnostics, Indianapolis, IN, USA), according to the manufacturer’s protocol for amplicons.
Emulsion PCR, breaking, and bead enrichment was carried out using the GS Junior Titanium emPCR Kit Lib-L, emPCR Reagents Lib-L kit, Oil and Breaking Kit, and the Bead Recovery Reagents Kit (Roche Diagnostics, Indianapolis, IN, USA), according to the supplier’s instructions. For emulsion PCR, we used a copy-per-bead ratio of 0.8. Enrichment of DNA-carrying beads was done with magnetic beads and a magnetic particle collector (Invitrogen, Carlsbad, CA, USA). To count the number of enriched beads, the GS Junior Bead Counter was used (Roche Diagnostics, Indianapolis, IN, USA). Finally, we loaded 100,000–500,000 beads onto the PicoTiterPlate (PTP) (Roche Diagnostics, Indianapolis, IN, USA). Sequencing was carried out using the GS Titanium Sequencing Kit (Roche Diagnostics, Indianapolis, IN, USA) and GS Junior device, according to standard Roche/454 protocols.Processed and quality-filtered reads were analyzed, and then, sequencing data were visualized using the GS Amplicon Variant Analyzer (Roche Diagnostics, Indianapolis, IN, USA). Target amplicons (excluding adaptors and multiplex identifiers) were used as references to align the amplicon reads. The template-specific portions of the fusion primers were considered as primer A and primer B, and the known mutations in the selected samples were defined as substitutions, insertions, or deletions, relative to the reference sequence.Poziotinib was administered orally, consecutively, and once daily in 21-day cycles, with a starting dose of 12 mg until evidence of progressive disease (PD) or intolerable adverse events (AEs). For patients who experienced drug-related AEs, treatment with poziotinib was interrupted until the AEs were resolved to the baseline level. The treatment was resumed at the previous dose or a dose reduction of 8 mg, and if a consecutive dose reduction below 8 mg once daily was required, the regimen was changed to intermittent dosing (i.e., 2 weeks of 8-mg poziotinib treatment followed by 1 week off treatment). Further dose reductions or up- titration after the reduction was not allowed. Afatinib was started from 40 mg/day and could be reduced to 20 mg/day by the treating physician, according to AEs as in his usual practice.Response to therapy was measured using RECIST v1.1 criteria16. Progression-free survival (PFS) was defined as the length of time during and after the treatment with HER2-targeted therapy that a patient lived with the disease and it did not get worse.
Results
We performed direct sequencing of the samples of 360 patients who were diagnosed with adenocarcinoma in the absence of EGFR mutation or ALK rearrangement. Among these cases, NGS was conducted in 129 patients, and finally, 29 (8.1%) patients with HER2 mutations were identified. Table 1 shows the clinical characteristics of all patients with the HER2 mutation. Most patients were female (58.6%) and had never smoked (70.0%). Thehistological type in all patients was adenocarcinoma, and clinical stage IV (55.2%) was the most prevalent. There was no evidence of coexisting EGFR mutation or ALK rearrangement. Despite two patients having a positive result for ALK immunohistochemistry analysis, they had a negative result for FISH. The most common type of HER2 mutation was p.G776>VC (c.2326_2327insTGT, 48.3%) in exon 20 (Fig. 1). Other insertion types were p.A775_G776insYVMA (c.2324_2325insATACGTGATGGC, 27.6%), p.G776>VV (c.2325_2329insGT-T, 6.9%), andp.P780_Y781insGSP (c.2339_2340insAGGCTCCCC, 3.4%). There were four cases of point mutations in exon 20.Among 29 patients with the HER2 mutation, seven patients received pan-HER inhibitors, which were composed of afatinib and poziotinib (Table 2). All seven were women, who had never smoked, with adenocarcinoma histology. The best response of one afatinib-treated patient had a partial response (PR). Poziotinib showed two PRs, three stable diseases (SDs), and one PD.
The one case (patient no. 4) with p.E812K (c.2434 G>A) mutation had no response to poziotinib therapy. The main toxicities associated with pan-HER inhibitor treatment were nausea, diarrhea, and mucositis. Six of seven patients (85.7%) reduced the starting dose owing to these toxicities. The specific case reports for two patients with a response to poziotinib follows.A 47-year-old woman, who had never smoked, was diagnosed with a stage IIIA (T2N2M0) adenocarcinoma in August 2014. Her initial tumor biopsy from a right lower lobar mass was negative for EGFR, ALK, and K-RAS mutation. After concurrent chemoradiotherapy, she received six cycles of pemetrexed for the control of the lung tumor. Upon progression of primary tumor on June 2016, her NGS finding showed HER2 exon 20 insertion (p.G776>VC). In July 2016, she started treatment with poziotinib (12 mg, daily), followed by a reduction in the dose (8 mg, daily) because of diarrhea (grade 2) and skin rash (grade 2). Six weeks later, follow-up imaging showed a PR, and the response duration was 18 weeks (Fig. 2A).Patient no. 2 was a 58-year-old woman who had never smoked and was diagnosed with a stage IV (T1aN3M1b) adenocarcinoma with metastases to both cervical lymph nodes and right pelvic bone in February 2015. Her initial tumor biopsy showed a negative result for EGFR and ALK alteration. After four cycles of pemetrexed/cisplatin, followed by four cycles of docetaxel, she received poziotinib (12 mg, daily) in August 2016, based on the NGS result of HER2 exon 20 insertion (p.A775_G776insYVMA). After 1 week, her dose was reduced to 8 mg because of diarrhea (grade 2). Six weeks later, follow-up imaging showed a PR, and the PFS was 5.5 months (Fig. 2B).
Discussion
HER2 (also known as ERBB2) is a member of the ERBB receptor tyrosine kinase family, which includes three additional members: EGFR (HER1/ERBB1), HER3 (ERBB3), and HER4 (ERBB4). The binding of ligands to the extracellular domain of EGFR, HER3, and HER4 induces homodimerization and heterodimerization of these receptors, thereby catalytically activating a cascade of intracellular pathways involved in cellular proliferation, differentiation, and migration2,5,17. Heterodimers between EGFR and HER2 are the most stable, thus resulting in augmentation of EGFR signaling by HER2, and HER2 mediates the sensitivity of EGFR-mutant lung tumors to anti-EGFR therapy 18. Oncogenic activation of HER2 may result from protein overexpression, gene copy number gain, and gene mutations that cause molecular alterations in the HER2 receptor4. HER2 mutations have been well studied in breast cancer, but in NSCLC, the importance of these mutations is still being explored.To date, a few studies regarding HER2 mutations in NSCLC have been published, with a reported incidence of 2%–4% of NSCLC cases4-6. HER2 mutations are typically observed with adenocarcinoma histology in never smokers and women19, usually mutually exclusive with EGFR, KRAS, and ALK mutations in NSCLC. In a selected population of EGFR/KRAS/ALK mutation-negative patients, the incidence can reach up to 6%7,20. The frequency of HER2 mutation was slightly higher in East Asian patients5,20-22 than in Western patients4,6,7,23. We found 8.1% of HER2 mutations in this study by a clinical and molecular enrichment strategy. Interestingly, nine (30%) patients were smokers, and this finding illustrates that clinical characteristics do not always predict the presence of molecular alterations.NGS is emerging as an important method for the identification of HER2 gene mutations.
This technique allows for parallel analysis of a very large number of DNA molecules using one platform and tumor specimen, with an ability to simultaneously test for mutations, rearrangements, and amplification4. NGS has an advantage compared to direct sequencing in detecting very rare mutations, even when the biopsy specimen is limited. In NSCLC, HER2 gene mutations occur in exons 18–21 of the tyrosine kinase domain and commonly alter the intracellular ATP-binding pocket of the HER2 receptor4. The majority were in-frame insertions in exon 20 of the kinase domain, which ranged from 3 to 12 base pairs (bps), all nested between codons 775 and 8317. The 12-bp insertion is known as the most common mutation showing duplication/insertion of four amino acids (YVMA) at codon 775 (p.A775_G776insYVMA)7. In addition, other reported mutations include the following: bp insertion (i.e., p.G776>VC, p.P780_Y781insGSP, p.V777_G778insCG), insertion/deletion (i.e., p.M774delinsWLV, p.G776>LC), or point mutations (i.e., p.L755S, p.G776C, p.V777L)6,7,24-26. In this study, we found a p.N813D (c.2437 A>G) point mutation in patient no. 7, who achieved PR by afatinib therapy. Given that most HER2 mutations were known to be found in the proximal region of exon 20, p.N813D is supposedly a novel and rare mutation in the distal region of exon 20. However, HER2 mutation testing in this study was limited to exon 20. Other HER2 mutations in the transmembrane and extracellular domains are also actionable but not covered in this study.Until further validation of the predictive value of NGS, clinicians need to approach HER2- mutant lung cancer with a more empiric approach that lacks guidelines about the optimal choice of molecular therapy and timing of administration4. In contrast to breast cancer, trastuzumab, a monoclonal antibody that targets extracellular domain IV of the HER2 receptor, has not shown a clear benefit as monotherapy27. The addition of trastuzumab to chemotherapy has shown mixed results6,28-30, but most of these patients were not selected based on their HER2 mutation status4.
Afatinib is a potent and irreversible pan-HER inhibitor with preclinical activity in Ba/F3 cells expressing an artificial HER2 mutant in a human lung cancer cell line with an insertional mutation at codon 77631. In the EUHER2 cohort, the overall response rate was 18.2%, and PFS was 3.9 months. Several results with afatinib in HER2-positive NSCLC have been promising6,25,26,30,32. Dacomitinib produced a 12% response rate and the median overall survival was 9 months in patients with specific HER2 exon 20 insertion mutation24. Neratinib in combination with temsirolimus also showed responses in two of 11 patients with HER2 mutant NSCLC in a phase I study 33.Poziotinib is a very potent pan-HER inhibitor and has been demonstrated as effective against the erlotinib-resistant EGFR p.T790M and EGFR p.L858R/p.T790M double mutant along with the inhibition of wild-type EGFR, HER2, and HER410. In a phase I study, to examine the safety and maximum tolerated dose (MTD) of continuous daily dosing of poziotinib in genetically unselected patients with advanced solid cancers including NSCLC, 20% of the patients (4/20) experienced PR, with an MTD of 18 mg and an acceptable toxicity profile, thus supporting further clinical development of poziotinib34. In three phase I studies, poziotinib was administered as an oral tablet once daily for 2 or 4 weeks according to the study protocol (daily for 2 weeks every 3 weeks or daily continuously dosing schedule) 35.Poziotinib is under phase II clinical trial for stage IV lung adenocarcinoma with HER2 mutation in Korea (ClinicalTrials.gov ID: NCT02979821). In our study, six patients were eligible to receive poziotinib in this phase II trial. Two patients showed PR, and the PFS was more than 4 months as shown Table 2. In our series and in previously published data, the response rate and duration are modest compared with those using tyrosine kinase inhibitors against other molecular drivers such as EGFR or ALK. However, most patients experienced toxicities such as diarrhea, rash, mucositis, or nausea; hence, dose reduction was inevitable. Despite these findings, we should wait for the final results of the phase II study, and poziotinib would be a potential HER2-targeted drug, if the toxicities are properly controlled.
Conclusions
We estimate that HER2 mutations occur at a frequency of approximately 8.1% in adenocarcinoma without EGFR or ALK molecular alteration. The sample size in this study is small; therefore, no conclusive statistical associations can be made regarding the effectiveness of targeted therapies or any factors that can predict responses to targeted therapies. However, we performed molecular profiling by NGS on all possible HER2-mutant cases regardless of any predefined selection criteria such as smoking history or histology.Because this study suggested a modest therapeutic activity of poziotinib or afatinib against HER2-mutant adenocarcinoma, further studies are needed to determine the true response rate and best-targeted therapies for this subset of Poziotinib lung cancer.